Filetype
Forskare Kontaktinformation E-post: heyjin [dot] kim [at] ekh [dot] lu [dot] se Telefon: +46 46 222 46 33 Mobil: +46 76 328 81 45Organisation Ekonomisk-historiska institutionen Besöksadress: Scheelevägen 15 B, Lund Rumsnummer: Alfa 1:2095 Hämtställe: 10 WebbplatsHeyjin Kims profil i Lunds universitets forskningsportal Publikationer Visar av publikationer. Sorterade efter år och sen titel. Filtrera
https://www.ehl.lu.se/heyjin-kim - 2026-07-09
Professor emeritus Kontaktinformation E-post: anders [dot] lindroth [at] mgeo [dot] lu [dot] seOrganisation Miljö- och geovetenskapliga institutionen (MGeo) Hämtställe: 16 WebbplatsAnders Lindroths profil i Lunds universitets forskningsportalAndra roller Medlem i Strategiskt forskningsområde BECC: Biodiversity and Ecosystem services in a Changing Climate Publikationer Visar av publikationer. Sorte
https://www.nateko.lu.se/sv/anders-lindroth - 2026-07-09
In order to enhance understanding of what factors influence the gender division of housework, this study investigates the association between households’ purchases of domestic services and women's share of unpaid domestic labour in Swedish heterosexual working couples. Findings from logistic regression analyses suggest that purchases of domestic services, in the literature sometimes also refer
Traditional change management models have been widely used to manage organisational change. However, this integrative literature review paper questions their relevance in environments characterised by complexity due to the intricate nature of challenges and uncertainties in these contexts. A novel framework is developed, encompassing key elements required to facilitate change in complex environmen
Residential energy consumption in Europe is unsustainable, relying heavily on fossil fuels and contributing to climate change. The European energy crisis, as a naturally occurring experiment, disrupted energy consumption in households due to drastically increased prices and raised public awareness while creating a unique opportunity to study the dynamics of change in household energy consumption.
Title: Kulturens påverkan på internationell inbound marketing Seminar date: 2/6/2021 Course: Bachelor's Thesis in Marketing, 15 credits Supervisor: Nikos Macheridis Keywords: Inbound marketing, Content marketing, Social media, Cultural dimension, Vogue, Cultural behavior, Culture, Color psychology, Luxury fashion. Purpose: Examine whether the content of Vogue's digital articles and Vogue&#
Throughout the 21st century migration has become increasingly politicised in Sweden, a trend that was further intensified by the migration crisis in 2015. This development significantly heightened media attention to migration and positioned it as a central concern among the Swedish public. There has been a significant shift in the political landscape in Europe and Sweden as well, where anti-immigr
The expansion of e-commerce and the consequent spatial changes raise questions about how accessibility and liveability for older people is considered in increasingly ageing societies. The aim of this article is to enhance the understanding of how digitally literate older people perceive e-commerce as a tool to accommodate their needs. The study therefore poses the question: How do digitally litera
The Covid-19 crisis has led to widespread impacts on society, not only in terms of high death tolls, but also in terms of cascading effects for essentially all societal sectors; especially due to all measures taken to reduce the spread of the disease. A range of actors have become involved in the response to the pandemic and to ensure appropriate actions being taken, these actors need good situatiThe Covid-19 crisis has led to widespread impacts on society, not only in terms of high death tolls, but also in terms of cascading effects for essentially all societal sectors; especially due to all measures taken to reduce the spread of the disease. A range of actors have become involved in the response to the pandemic and to ensure appropriate actions being taken, these actors need good situati
The purpose of this study is to examine depression in regard to the shifting paradigms of psychiatry, which could possibly be tied to the shifting economic policies in western society at large. The methodological approach in doing this has been one of studying literature regarding past and present psychiatric paradigms, as well as literature on the economic paradigms of recent history, and interpr
Diabetes mellitus is metabolic disorder caused by a defect or lack of beta cell-produced insulin that controls blood glucose homeostasis. In addition to glucose, insulin secretion is regulated by the autonomic nervous system (ANS); the neurotransmitter acetylcholine as well as monoamines, such as dopamine, serotonin, melatonin and norepinephrine. Using a MafA mutant mouse model, we show that MafA
Aims To evaluate premature mortality and causes of death from young adulthood to middle age in a cohort of drug users followed during almost four decades Design Follow-up study of a consecutive cohort of patients with drug abuse/dependence. Methods A cohort of 561 drug abusers, admitted to a detoxification and short-term rehabilitation unit 1970–1978 was followed to December 31st, 2006. Standard
The contribution of this licentiate thesis lies in the modelling of a multi-echelon inventory system with more general backorder cost structures. Backorder costs are traditionally assumed to be linear, whereas we consider structures that are more general functions of the customers’ time in backorder. The system studied is a two-echelon system with one central warehouse and a number of local sites,
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
With the European minimum wage directive adopted in 2022, all European countries will be obliged to protect and promote collective bargaining. Where collective bargaining coverage is below 80 per cent, they will be obliged to draw up and implement national action plans in 2025 to increase coverage. This will be the first time in history for so many European countries to be legally obliged to think
The European Union is a large organ that is constantly under reformation. EU and the Common Agricultural Policy has during its lifetime gone through several major reforms in order to adjust regulations for certain markets. Our study will pay focus on the Sugar reform that was implemented in year 2006 and what effects it had on the European sugar market. The purpose of the reform was to give more p
Universitetslektor Kontaktinformation E-post: nikos [dot] macheridis [at] fek [dot] lu [dot] se Telefon: +46 46 222 78 60Organisation Strategi Rumsnummer: Alfa 5,6 rum B424 Hämtställe: 10 WebbplatsNikos Macheridis profil i Lunds universitets forskningsportal Publikationer Visar av publikationer. Sorterade efter år och sen titel. Filtrera efter typ AllaAntologi (redaktör)Artikel i vetenskaplig tids
https://www.ehl.lu.se/nikos-macheridis - 2026-07-08
Professor emeritus Kontaktinformation E-post: bjorn [dot] hansson [at] nek [dot] lu [dot] se Telefon: +46 46 222 93 90Organisation Nationalekonomiska institutionen Rumsnummer: Alfa1:4036A Hämtställe: 10 WebbplatsBjörn Hanssons profil i Lunds universitets forskningsportal Publikationer Visar av publikationer. Sorterade efter år och sen titel. Filtrera efter typ AllaArtikel i vetenskaplig tidskriftB
https://www.ehl.lu.se/bjorn-hansson - 2026-07-08
