Sökresultat

https://rwi.lu.se/news-tags/cop26/ - 2026-06-05

https://rwi.lu.se/young-voices-from-cop26/ - 2026-06-05

https://rwi.lu.se/news/cop26-rwi-goes-to-glasgow/ - 2026-06-06

Geophysical methods are prone to fail in an urban environment as all sources of noise are present in cities. The Fælledparken Park, a large open space area in Copenhagen, Denmark is not an exception. However, an extension of the metro along sections of high variability on the surface of a limestone surface motivated the use of geoelectrics as complement to seismic methods. The site conditions have

Checklista för uppdragsavtal Forskningsservice Sophie Hydén Picasso Finansieringsmetoder för excellens PLANERA EN AKADEMISK KARRIÄR En akademisk karriär är ofta mångfacetterad, och dess olika delar ställer krav på olika typer av egenskaper och färdigheter. Olika karriärprofiler och vägar framåt kan överlappa och kombineras, alternativt så rör man sig mer etappvis längst karriärvägen. Forskning, un

https://www.medarbetarwebben.lu.se/sites/medarbetarwebben.lu.se/files/finansieringsmetoder-for-excellens.pdf - 2026-06-07

In contemporary tourism, technology enables travelers to make travel arrangements in various ways, for example they can reserve tickets directly from airlines company’s website or purchase products from online travel agencies. Considering that travelers have many alternatives but insist in making transactions with traditional travel agencies, there must be something that makes traditional travel a

https://www.hr-webben.lu.se/instructions-work-environment-collaboration-within-central-health-and-safety-committee-lund - 2026-06-05

https://www.ctr.lu.se/fileadmin/user_upload/ctr/pdf/forskarseminarier/f-sem-vt26/VT26_Program.pdf - 2026-06-06

https://konferens.ht.lu.se/glow-36/ - 2026-06-06

https://www.pompejiprojektet.se/insula-v-1/documentation-of-insula-v-1/archive-main-documentation/v-126-casa-di-caecilius-iucundus-south-house/ - 2026-06-06

https://www.sol.lu.se/media/utbildning/dokument/kurser/FONM26/20212/FONM26_SLUTLIG.pdf - 2026-06-06

https://www.sol.lu.se/media/utbildning/dokument/kurser/FIMT26/20241/ReadingFIMT26.pdf - 2026-06-07

https://rwi.lu.se/events/how-climate-change-and-human-rights-are-connected/ - 2026-06-07

https://rwi.lu.se/blog-tags/cop26/ - 2026-06-07

In 2021, the EU announced the introduction of a carbon border adjustment mechanism (CBAM) to address the carbon leakage problem, which hampers its efforts to mitigate climate change. One of the CBAM requirements is that if an export party can provide that it paid for used carbon domestically, the corresponding amount will be deducted from the EU importers. After the announcement, Russia, one of th

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

As a consequence of agricultural intensification, large areas of species-rich grasslands have been lost and farmland biodiversity has declined. Previous studies have shown that the continuity of grazing management can have a significant influence on the environmental conditions and the levels of plant species diversity in grassland habitats. The preservation of species-rich grasslands has become a

In this paper the Rawlsian contractual method–including the original position and the veil of ignorance–is used to create principles of security. The method enables transcendence from contemporary restrictions to a broadened view where general principles guide us to the most important aspects of security. The principles guide us to the core. I arrive at two and only two principles: existential sec