Sökresultat

Välja träning efter gener – Vetenskap och Hälsa Hoppa till innehåll Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Välja träning efter gener 2024-01-26 Illustration: iStock/Tingting Ji ”Vi vet att träning fungerar olika för olika människor, men än så länge vet vi inte varför.” Det säger Ola Hansson som forskar

https://www.vetenskaphalsa.se/valja-traning-efter-gener/ - 2026-07-06

Courses | Centre for Mathematical Sciences Skip to main content This site uses cookies to enhance the user experience. By continuing to use the site you agree that cookies are used according to our Cookie Policy (on the website of LTH) . Essential cookies These cookies are necessary for the website to function and cannot be turned off in our systems. These cookies do not store any personally ident

https://www.maths.lu.se/english/education/all-courses/courses-faculty-of-science/ - 2026-07-06

Title: Kulturens påverkan på internationell inbound marketing Seminar date: 2/6/2021 Course: Bachelor's Thesis in Marketing, 15 credits Supervisor: Nikos Macheridis Keywords: Inbound marketing, Content marketing, Social media, Cultural dimension, Vogue, Cultural behavior, Culture, Color psychology, Luxury fashion. Purpose: Examine whether the content of Vogue's digital articles and Vogue&#

Purpose: To propose a blueprint of how the policymakers responsible for health care reforms in the county of Scania (Sweden) could evaluate a prospective stroke care intervention from a societal point of view. More specifically, the intervention will consist in the introduction of telemedicine technology to their ambulance fleet. In addition, key methodological issues, of interest to the policymak

Purpose: The hippocampus is affected by tau pathology early in Alzheimer's disease (AD) development. Accurate quantification of hippocampal tau signal using the tau-PET tracer 18F-flortaucipir is complicated, however, by off-target binding in the adjacent choroid plexus. We here present a new method for compensating for this off-target choroid plexus signal. Methods: As off-target binding in the c

Version management is a prerequisite for digital information flow between phases in the planning and building processes. Information evolves over time and many parties retrieve information from the various phases. The aim of this article is to evaluate versioning methods, focusing on geodata buildings in the 3D cadastre process. The main attention in the evaluation is on the comprehensive ISO stan

This Report summarizes the results of the activities of the LHC Higgs Cross Section Working Group in the period 2014-2016. The main goal of the working group was to present the state-of-the-art of Higgs physics at the LHC, integrating all new results that have appeared in the last few years. The first part compiles the most up-to-date predictions of Higgs boson production cross sections and decay

Objectives: The aim of this study was to explore next of kin’s experiences ofinformation and their information needs after the patient’s discharge for colorectal cancer surgery.Methods: Sixteen next of kin were interviewed twice during the first seven weeksafter the patient’s discharge from hospital. The interviews were analysed through qualitative content analysis.Results: The participants in thiObjectives: The aim of this study was to explore next of kin’s experiences of information and their information needs after the patient’s discharge for colorectal cancer surgery.Methods: Sixteen next of kin were interviewed twice during the first seven weeks after the patient’s discharge from hospital. The interviews were analysed through qualitative content analysis.Results: The participants in t

This paper investigates the effectiveness of lighting control systems (LCSs) in 57 individual office rooms of an educational building located in Lund, Sweden. The study uses simulations based on actual occupancy data. The simulations, performed with Daysim via the Honeybee interface, focus on the portion of standby energy use on total lighting energy use considering different combinations of LCSs

The contribution of this licentiate thesis lies in the modelling of a multi-echelon inventory system with more general backorder cost structures. Backorder costs are traditionally assumed to be linear, whereas we consider structures that are more general functions of the customers’ time in backorder. The system studied is a two-echelon system with one central warehouse and a number of local sites,

Objective: This study examined whether previously reported results, indicating that prostate-specific antigen (PSA) screening can reduce prostate cancer (PC) mortality regardless of sociodemographic inequality, could be corroborated in an 18 year follow-up. Materials and methods: In 1994, 20,000 men aged 50–64 years were randomized from the Göteborg population register to PSA screening or control

Objective: Patients with degenerative or traumatic meniscal tears are at high risk of developing knee osteoarthritis. We investigated if younger (≤40 years) and older (>40 years) patients with preoperative mechanical symptoms (MS) improved more in patient-reported outcomes after meniscal surgery than those without MS. Design: Patients from Knee Arthroscopy Cohort Southern Denmark (KACS) undergoing

The flux during membrane filtration can be enhanced by the use of a two-phase gas–liquid flow. This has been shown to be an energy-efficient alternative to increasing the cross-flow velocity. In this work, air sparging was used to increase the flux during ultrafiltration of alkali-extracted wheat bran hemicelluloses. Batch filtration was performed in a pilot unit with a ceramic ultrafiltration mem

Forest ecosystems, covering over a third of land on the Earth, play a significant role in the global hydrological cycle, and influence soil erosion and climate change. However, the distribution, movements, quality of water, and hydrological processes in forested ecosystems are not well understood yet. This thesis aims to improve our understanding of the interaction between forest ecosystems and waForest ecosystems, covering over a third of land on the Earth, play a significant role in the global hydrological cycle, and influence soil erosion and climate change. However, the distribution, movements, quality of water, and hydrological processes in forested ecosystems are not well understood yet. This thesis aims to improve our understanding of the interaction between forest ecosystems and wa

Because of the important role of membrane proteins in adhesion, invasion, and intracellular survival of pathogens in the host, membrane proteins are of potential interest in the search for drug targets or biomarkers. We have established a mass spectrometry-based method that allows characterization of the outer membrane protein (OMP) profile of clinical isolates from of the human gastric pathogen H

OBJECTIVES: To evaluate diagnostic performance and actual costs in clinical practice of IgG/IgA deamidated gliadin peptide antibodies (DGP) as a complement to IgA antibodies against tissue transglutaminase (tTG) for the diagnosis of pediatric celiac disease (CD). PATIENTS AND METHODS: All consecutive patients <18 years tested for tTG and/or DGP and who underwent duodenal biopsy because of suspec

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Background Previous Studies have shown increased familial risk for chronic lymphocytic leukemia. In the most comprehensive study to date, we evaluated risk of chronic lymphocytic leukemia and lymphoproliferative disorders among First-degree relatives of chronic lymphocytic leukemia cases compared to first-degree relatives of controls. Design and Methods Population-based registry data from Sweden w

Diabetes mellitus is metabolic disorder caused by a defect or lack of beta cell-produced insulin that controls blood glucose homeostasis. In addition to glucose, insulin secretion is regulated by the autonomic nervous system (ANS); the neurotransmitter acetylcholine as well as monoamines, such as dopamine, serotonin, melatonin and norepinephrine. Using a MafA mutant mouse model, we show that MafA

Children diagnosed with noncentral nervous system solid cancers (NCNSSC) experience several adverse late effects, including second malignant neoplasm. The aim of our study was to assess the risk of specific second malignancies after a childhood NCNSSC. Diagnosis and follow-up data on 10,988 cases of NCNSSC in children (0-14 years) were obtained from 13 registries. Standardized incidence ratios (SI